neet-2023
NEET 2023
MEDICAL 2023 Previous Year
3 hDuration
688Total Marks
172Questions
3Sections
Instructions
General instructions for this test:
- Duration: 3 h. The timer starts as soon as you begin and cannot be paused.
- Total questions: 172 across 3 section(s); maximum marks: 688.
- You are allowed 1 attempt(s) at this test.
- Use the question palette on the right to navigate. Answered questions are highlighted in green; questions marked for review are highlighted in yellow.
- Each question's marking scheme (correct / wrong) is shown on the question card. Unanswered questions receive zero marks.
- Switching tabs, exiting full-screen, or attempting to copy text is monitored. Repeated tab-switching may auto-submit the test.
- Your answers autosave as you navigate. Click Submit Test when you are done. The test will be auto-submitted when the timer expires.
No exam-specific instructions were provided for this paper.
Paper Structure
Chemistry
Chemistry
Q1.
mcq single
+4 / 1
The stability of $$\mathrm{Cu}^{2+}$$ is more than $$\mathrm{Cu}^{+}$$ salts in aqueous solution due to -
Q2.
mcq single
+4 / 1
Which of the following statements are INCORRECT?
A. All the transition metals except scandium form MO oxides which are ionic.
B. The highest oxidation number corresponding to the group number in transition metal oxides is attained in $$\mathrm{Sc}_{2} \mathrm{O}_{3}$$ to $$\mathrm{Mn}_{2} \mathrm{O}_{7}$$.
C. Basic character increases from $$\mathrm{V}_{2} \mathrm{O}_{3}$$ to $$\mathrm{V}_{2} \mathrm{O}_{4}$$ to $$\mathrm{V}_{2} \mathrm{O}_{5}$$.
D. $$\mathrm{V}_{2} \mathrm{O}_{4}$$ dissolves in acids to give $$\mathrm{VO}_{4}^{3-}$$ salts.
E. $$\mathrm{CrO}$$ is basic but $$\mathrm{Cr}_{2} \mathrm{O}_{3}$$ is amphoteric.
Choose the correct answer from the options given below:
Q3.
mcq single
+4 / 1
Amongst the following, the total number of species NOT having eight electrons around central atom in its outer most shell, is
$$\mathrm{NH}_{3}, \mathrm{AlCl}_{3}, \mathrm{BeCl}_{2}, \mathrm{CCl}_{4}, \mathrm{PCl}_{5}$$ :
Q4.
mcq single
+4 / 1
Taking stability as the factor, which one of the following represents correct relationship?
Q5.
mcq single
+4 / 1
Intermolecular forces are forces of attraction and repulsion between interacting particles that will include:
A. dipole - dipole forces.
B. dipole - induced dipole forces
C. hydrogen bonding
D. covalent bonding
E. dispersion forces
Choose the most appropriate answer from the options given below :
Q6.
mcq single
+4 / 1
The correct order of energies of molecular orbitals of $$\mathrm{N}_{2}$$ molecule, is
Q7.
mcq single
+4 / 1
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : A reaction can have zero activation energy.
Reason R : The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.
In the light of the above statements, choose the correct answer from the options given below:
Q8.
mcq single
+4 / 1
For a certain reaction, the rate $$=\mathrm{k}[\mathrm{A}]^{2}[\mathrm{~B}]$$, when the initial concentration of A is tripled keeping concentration of $$\mathrm{B}$$ constant, the initial rate would
Q9.
mcq single
+4 / 1
On balancing the given redox reaction,
$$\mathrm{aCr}_{2} \mathrm{O}_{7}^{2-}+\mathrm{bSO}_{3}^{2-}(\mathrm{aq})+\mathrm{cH}^{+}(\mathrm{aq}) \rightarrow 2 \mathrm{aCr}^{3+}(\mathrm{aq})+\mathrm{bSO}_{4}^{2-}(\mathrm{aq})+\frac{\mathrm{c}}{2} \mathrm{H}_{2} \mathrm{O}(\ell)$$
the coefficients $$\mathrm{a}, \mathrm{b}$$ and $$\mathrm{c}$$ are found to be, respectively -
Q10.
mcq single
+4 / 1
The given compound
is an example of _________.
is an example of _________.
Q11.
mcq single
+4 / 1
The right option for the mass of $$\mathrm{CO}_{2}$$ produced by heating $$20 \mathrm{~g}$$ of $$20 \%$$ pure limestone is
(Atomic mass of $$\mathrm{Ca}=40$$ )
$$\left[\mathrm{CaCO}_{3} \stackrel{1200 \mathrm{~K}}{\longrightarrow} \mathrm{CaO}+\mathrm{CO}_{2}\right]$$
Q12.
mcq single
+4 / 1
Which amongst the following options is the correct relation between change in enthalpy and change in internal energy?
Q13.
mcq single
+4 / 1
The equilibrium concentrations of the species in the reaction $$\mathrm{A}+\mathrm{B} \rightleftharpoons \mathrm{C}+\mathrm{D}$$ are $$2,3,10$$ and $$6 \mathrm{~mol}$$ $$\mathrm{L}^{-1}$$, respectively at $$300 \mathrm{~K} . \Delta \mathrm{G}^{0}$$ for the reaction is $$(\mathrm{R}=2 \mathrm{cal} / \mathrm{mol} ~\mathrm{K})$$
Q14.
mcq single
+4 / 1
The element expected to form largest ion to achieve the nearest noble gas configuration is
Q15.
mcq single
+4 / 1
Match List I with List II:
List I
List II
(A)
Coke
(I)
Carbon atoms are sp$$^3$$ hybridised
(B)
Diamond
(II)
Used as a dry lubricant
(C)
Fullerene
(III)
Used as a reducing agent
(D)
Graphite
(IV)
Cage like molecules
Choose the correct answer from the options given below:
Q16.
mcq single
+4 / 1
Match List I with List II:
List I
(Oxoacids of Sulphur)
List II
(Bonds)
(A)
Peroxodisulphuric acid
(I)
Two S-OH, Four S=O, One S-O-S
(B)
Sulphuric acid
(II)
Two S-OH, One S=O
(C)
Pyrosulphuric acid
(III)
Two S-OH, Four S=O, One S-O-O-S
(D)
Sulphurous acid
(IV)
Two S-OH, Two S=O
Choose the correct answer from the options given below:
Q17.
mcq single
+4 / 1
Given below are two statements : one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Helium is used to dilute oxygen in diving apparatus.
Reason R : Helium has high solubility in O$$_2$$.
In the light of the above statements, choose the correct answer from the options given below:
Q18.
mcq single
+4 / 1
Which complex compound is most stable?
Q19.
mcq single
+4 / 1
Homoleptic complex from the following complexes is :
Q20.
mcq single
+4 / 1
Consider the following compounds/species:
The number of compounds/species which obey Huckel's rule is ___________.
The number of compounds/species which obey Huckel's rule is ___________.
Q21.
mcq single
+4 / 1
The number of $$\sigma$$ bonds, $$\pi$$ bonds and lone pair of electrons in pyridine, respectively are:
Q22.
mcq single
+4 / 1
In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with $$\mathrm{Fe}^{3+}$$ due to the formation of-
Q23.
mcq single
+4 / 1
Amongst the given options which of the following molecules/ion acts as a Lewis acid?
Q24.
mcq single
+4 / 1
Complete the following reaction:
[C] is _______.
[C] is _______.
Q25.
mcq single
+4 / 1
Identify the final product [D] obtained in the following sequence of reactions.


Q26.
mcq single
+4 / 1
Identify the major product obtained in the following reaction:


Q27.
mcq single
+4 / 1
Consider the following reaction and identify the product (P).


Q28.
mcq single
+4 / 1
Which amongst the following will be most readily dehydrated under acidic conditions?
Q29.
mcq single
+4 / 1
Consider the following reaction
Identify products A and B :-
Identify products A and B :-
Q30.
mcq single
+4 / 1
Identify product $$(\mathrm{A})$$ is the following reaction :


Q31.
mcq single
+4 / 1
Given below are two statements:
Statement I : A unit formed by the attachment of a base to 1' position of sugar is known as nucleoside
Statement II : When nucleoside is linked to phosphorous acid at 5' position of sugar moiety, we get nucleotide.
In the light of the above statements, choose the correct answer from the options given below:
Q32.
mcq single
+4 / 1
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R:
Assertion A : In equation $$\mathrm{\Delta_rG=-nFE_{cell}}$$, value of $$\mathrm{\Delta_rG}$$ depends on n.
Reason R : $$\mathrm{E_{cell}}$$ is an intensive property and $$\mathrm{\Delta_rG}$$ is an extensive property.
In the light of the above statements, choose the correct answer from the options given below:
Q33.
mcq single
+4 / 1
The conductivity of centimolar solution of $$\mathrm{KCl}$$ at $$25^{\circ} \mathrm{C}$$ is $$0.0210 ~\mathrm{ohm}^{-1} \mathrm{~cm}^{-1}$$ and the resistance of the cell containing the solution at $$25^{\circ} \mathrm{C}$$ is $$60 ~\mathrm{ohm}$$. The value of cell constant is -
Q34.
mcq single
+4 / 1
Identify the product in the following reaction:


Q35.
mcq single
+4 / 1
Which of the following reactions will NOT give primary amine as the product?
Q36.
mcq single
+4 / 1
The relation between $$\mathrm{n}_{\mathrm{m}},\left(\mathrm{n}_{\mathrm{m}}=\right.$$ the number of permissible values of magnetic quantum number $$(\mathrm{m})$$) for a given value of azimuthal quantum number $$(l)$$, is
Q37.
mcq single
+4 / 1
Select the correct Statements from the following :
A. Atoms of all elements are composed of two fundamental particles.
B. The mass of the electron is $$9.10939 \times 10^{-31} \mathrm{~kg}$$.
C. All the isotopes of a given elements show same chemical properties.
D. Protons and electrons are collectively known as nucleons.
E. Dalton's atomic theory, regarded the atom as an ultimate particle of matter.
Choose the correct answer from the options given below.
Physics
Physics
Q1.
mcq single
+4 / 1
For Young's double slit experiment, two statements are given below :
Statement I : If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement II : If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.
In the light of the above statements, choose the correct answer from the options given below :
Q2.
mcq single
+4 / 1
The ratio of radius of gyration of a solid sphere of mass $$M$$ and radius $$R$$ about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is :-
Q3.
mcq single
+4 / 1
The angular acceleration of a body, moving along the circumference of a circle, is :
Q4.
mcq single
+4 / 1
The net magnetic flux through any closed surface is :
Q5.
mcq single
+4 / 1
A metal wire has mass $$(0.4 \pm 0.002) ~\mathrm{g}$$, radius $$(0.3 \pm 0.001) ~\mathrm{mm}$$ and length $$(5 \pm 0.02) ~\mathrm{cm}$$. The maximum possible percentage error in the measurement of density will nearly be :
Q6.
mcq single
+4 / 1
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are :
Q7.
mcq single
+4 / 1
The temperature of a gas is $$-50^{\circ} \mathrm{C}$$. To what temperature the gas should be heated so that the rms speed is increased by $$3$$ times?
Q8.
mcq single
+4 / 1
A Carnot engine has an efficiency of $$50 \%$$ when its source is at a temperature $$327^{\circ} \mathrm{C}$$. The temperature of the sink is :-
Q9.
mcq single
+4 / 1
The venturi-meter works on :
Q10.
mcq single
+4 / 1
The amount of energy required to form a soap bubble of radius $$2 \mathrm{~cm}$$ from a soap solution is nearly: (surface tension of soap solution $$=0.03 \mathrm{~N} \mathrm{~m}^{-1}$$ )
Q11.
mcq single
+4 / 1
Let a wire be suspended from the ceiling (rigid support) and stretched by a weight $$W$$ attached at its free end. The longitudinal stress at any point of cross-sectional area $$A$$ of the wire is :
Q12.
mcq single
+4 / 1
An electric dipole is placed as shown in the figure.
The electric potential (in 10^(2) V) at point P due to the dipole is ($$\in_0$$ = permittivity of free space and $$\frac{1}{4 \pi \epsilon_{0}}$$ = K) :
The electric potential (in 10^(2) V) at point P due to the dipole is ($$\in_0$$ = permittivity of free space and $$\frac{1}{4 \pi \epsilon_{0}}$$ = K) :
Q13.
mcq single
+4 / 1
An electric dipole is placed at an angle of $$30^{\circ}$$ with an electric field of intensity $$2 \times 10^{5} \mathrm{NC}^{-1}$$. It experiences a torque equal to $$4 ~\mathrm{N~m}$$. Calculate the magnitude of charge on the dipole, if the dipole length is $$2 \mathrm{~cm}$$.
Q14.
mcq single
+4 / 1
If $$\oint_\limits{s} \vec{E} \cdot \overrightarrow{d S}=0$$ over a surface, then:
Q15.
mcq single
+4 / 1
Two bodies of mass $$m$$ and $$9 m$$ are placed at a distance $$R$$. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be ($$G=$$ gravitational constant) :
Q16.
mcq single
+4 / 1
A satellite is orbiting just above the surface of the earth with period $$T$$. If $$d$$ is the density of the earth and $$G$$ is the universal constant of gravitation, the quantity $$\frac{3 \pi}{G d}$$ represents :
Q17.
mcq single
+4 / 1
The equivalent capacitance of the system shown in the following circuit is:


Q18.
mcq single
+4 / 1
Two thin lenses are of same focal lengths $$(f)$$, but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be :
Q19.
mcq single
+4 / 1
Light travels a distance $$\mathrm{x}$$ in time $$t_{1}$$ in air and $$10 \mathrm{x}$$ in time $$t_{2}$$ in another denser medium. What is the critical angle for this medium?
Q20.
mcq single
+4 / 1
In the figure shown here, what is the equivalent focal length of the combination of lenses (Assume that all layers are thin) ?


Q21.
mcq single
+4 / 1
The $$x$$ - $$t$$ graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at $$t=2 \mathrm{~s}$$ is :


Q22.
mcq single
+4 / 1
For the following logic circuit, the truth table is:


Q23.
mcq single
+4 / 1
Given below are two statements:
Statement I : Photovoltaic devices can convert optical radiation into electricity.
Statement II : Zener diode is designed to operate under reverse bias in breakdown region.
In the light of the above statements, choose the most appropriate answer from the options given below :
Q24.
mcq single
+4 / 1
A full wave rectifier circuit consists of two p-n junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
Q25.
mcq single
+4 / 1
A very long conducting wire is bent in a semi-circular shape from $$A$$ to $$B$$ as shown in figure. The magnetic field at point $$P$$ for steady current configuration is given by :


Q26.
mcq single
+4 / 1
A wire carrying a current $$I$$ along the positive $$\mathrm{x}$$-axis has length $$L$$. It is kept in a magnetic field $$\overrightarrow{\mathrm{B}}=(2 \hat{\mathrm{i}}+3 \hat{\mathrm{j}}-4 \hat{\mathrm{k}}) \mathrm{T}$$. The magnitude of the magnetic force acting on the wire is :
Q27.
mcq single
+4 / 1
The minimum wavelength of $$X$$-rays produced by an electron accelerated through a potential difference of $$V$$ volts is proportional to :
Q28.
mcq single
+4 / 1
The work functions of Caesium $$(\mathrm{Cs})$$, potassium $$(\mathrm{K})$$ and Sodium (Na) are $$2.14 ~\mathrm{eV}, 2.30 ~\mathrm{eV}$$ and $$2.75 ~\mathrm{eV}$$ respectively. If incident electromagnetic radiation has an incident energy of $$2.20 ~\mathrm{eV}$$, which of these photosensitive surfaces may emit photoelectrons?
Q29.
mcq single
+4 / 1
A vehicle travels half the distance with speed $$v$$ and the remaining distance with speed $$2 v$$. Its average speed is :
Q30.
mcq single
+4 / 1
The radius of inner most orbit of hydrogen atom is $$5.3 \times 10^{-11} \mathrm{~m}$$. What is the radius of third allowed orbit of hydrogen atom?
Q31.
mcq single
+4 / 1
In hydrogen spectrum, the shortest wavelength in the Balmer series is $$\lambda$$. The shortest wavelength in the Bracket series is :
Q32.
mcq single
+4 / 1
A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $$4 \mathrm{~m} \mathrm{~s}^{-1}$$. The ball strikes the water surface after $$4 \mathrm{~s}$$. The height of bridge above water surface is (Take $$g=10 \mathrm{~m} \mathrm{~s}^{-2}$$ )
Q33.
mcq single
+4 / 1
A bullet is fired from a gun at the speed of $$280 \mathrm{~ms}^{-1}$$ in the direction $$30^{\circ}$$ above the horizontal. The maximum height attained by the bullet is
$$\left(g=9.8 \mathrm{~ms}^{-2}, \sin 30^{\circ}=0.5\right)$$:-
Q34.
mcq single
+4 / 1
The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is
Q35.
mcq single
+4 / 1
Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is 0.15
$$\left(g=10 \mathrm{~m} \mathrm{~s}^{-2}\right)$$.
Q36.
mcq single
+4 / 1
A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is :
Q37.
mcq single
+4 / 1
A bullet from a gun is fired on a rectangular wooden block with velocity $$u$$. When bullet travels $$24 \mathrm{~cm}$$ through the block along its length horizontally, velocity of bullet becomes $$\frac{u}{3}$$. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is :
Q38.
mcq single
+4 / 1
The potential energy of a long spring when stretched by $$2 \mathrm{~cm}$$ is U. If the spring is stretched by $$8 \mathrm{~cm}$$, potential energy stored in it will be :
Q39.
mcq single
+4 / 1
The magnitude and direction of the current in the following circuit is :-


Q40.
mcq single
+4 / 1
The resistance of platinum wire at $$0^{\circ} \mathrm{C}$$ is $$2 ~\Omega$$ and $$6.8 ~\Omega$$ at $$80^{\circ} \mathrm{C}$$. The temperature coefficient of resistance of the wire is :
Q41.
mcq single
+4 / 1
If the galvanometer $$G$$ does not show any deflection in the circuit shown, the value of $$R$$ is given by:


Q42.
mcq single
+4 / 1
Resistance of a carbon resistor determined from colour codes is $$(22000 \pm 5 \%) \Omega$$. The colour of third band must be :
Q43.
mcq single
+4 / 1
10 resistors, each of resistance $$\mathrm{R}$$ are connected in series to a battery of emf $$E$$ and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased $$n$$ times. The value of $$n$$ is :
Q44.
mcq single
+4 / 1
In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $$2.0 \times 10^{10} \mathrm{~Hz}$$ and amplitude $$48 ~\mathrm{Vm}^{-1}$$. Then the amplitude of oscillating magnetic field is : (Speed of light in free space $$=3 \times 10^{8} \mathrm{~m} \mathrm{~s}^{-1}$$ )
Q45.
mcq single
+4 / 1
An ac source is connected to a capacitor C. Due to decrease in its operating frequency
Q46.
mcq single
+4 / 1
In a series LCR circuit, the inductance $$L$$ is $$10 ~\mathrm{mH}$$, capacitance $$C$$ is $$1 ~\mu \mathrm{F}$$ and resistance $$R$$ is $$100 ~\Omega$$. The frequency at which resonance occurs is :-
Q47.
mcq single
+4 / 1
A $$12 \mathrm{~V}, 60 \mathrm{~W}$$ lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of $$220 \mathrm{~V}$$. Assuming the transformer to be ideal, what is the current in the primary winding ?
Q48.
mcq single
+4 / 1
The magnetic energy stored in an inductor of inductance $$4 ~\mu \mathrm{H}$$ carrying a current of $$2 \mathrm{~A}$$ is :
Q49.
mcq single
+4 / 1
The net impedance of circuit (as shown in figure) will be :


Biology
Biology
Q1.
mcq single
+4 / 1
Which one of the following statements is NOT correct?
Q2.
mcq single
+4 / 1
In the equation GPP $$-$$ R = NPP
GPP is Gross Primary Productivity
NPP is Net Primary Productivity
R here is __________.
Q3.
mcq single
+4 / 1
Match List I with List II:
List I
(Interaction)
List II
(Species A and B)
(A)
Mutualism
(I)
+(A), 0(B)
(B)
Commensalism
(II)
$$-$$(A), 0(B)
(C)
Amensalism
(III)
+(A), $$-$$(B)
(D)
Parasitism
(IV)
+(A), +(B)
Choose the correct answer from the options given below:
Q4.
mcq single
+4 / 1
Identify the correct statements :
A. Detrivores perform fragmentation.
B. The humus is further degraded by some microbes during mineralization.
C. Water soluble inorganic nutrients go down into the soil and get precipitated by a process called
leaching.
D. The detritus food chain begins with living organisms.
E. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the options given below :
Q5.
mcq single
+4 / 1
Broad palm with single palm crease is visible in a person suffering from-
Q6.
mcq single
+4 / 1
The phenomenon of pleiotropism refers to
Q7.
mcq single
+4 / 1
Which one of the following symbols represents mating between relatives in human pedigree analysis?
Q8.
mcq single
+4 / 1
Frequency of recombination between gene pairs on same chromosome as a measure of the distance
between genes to map their position on chromosome, was used for the first time by
Q9.
mcq single
+4 / 1
Which of the following statements are correct about Klinefelter’s Syndrome?
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
Choose the correct answer from the options given below :
Q10.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Mast cells
(I)
Ciliated epithelium
(B)
Inner surface of bronchiole
(II)
Areolar connective tissue
(C)
Blood
(III)
Cuboidal epithelium
(D)
Tubular parts of nephron
(IV)
Specialised connective tissue
Choose the correct answer from the options give below:
Q11.
mcq single
+4 / 1
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
Q12.
mcq single
+4 / 1
In cockroach, excretion is brought about by -
A. Phallic gland
B. Urecose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Choose the correct answer from the options given below :
Q13.
mcq single
+4 / 1
Given below are two statements:
Statement I : Ligaments are dense irregular tissue.
Statement II : Cartilage is dense regular tissue.
In the light of the above statements, choose the correct answer from the options given below:
Q14.
mcq single
+4 / 1
How many ATP and NADPH~2~ are required for the synthesis of one molecule of Glucose during Calvin cycle?
Q15.
mcq single
+4 / 1
The reaction centre in PS II has an absorption maxima at
Q16.
mcq single
+4 / 1
Radial symmetry is NOT found in adults of phylum ______.
Q17.
mcq single
+4 / 1
Select the correct statements with reference to chordates.
A. Presence of a mid-dorsal, solid and double nerve cord.
B. Presence of closed circulatory system.
C. Presence of paired pharyngeal gill slits.
D. Presence of dorsal heart
E. Triploblastic pseudocoelomate animals.
Choose the correct answer from the options given below:
Q18.
mcq single
+4 / 1
The unique mammalian characteristics are :
Q19.
mcq single
+4 / 1
Identify the pair of heterosporous pteridophytes among the following :
Q20.
mcq single
+4 / 1
Given below are two statements : One labelled as Assertion A and the other labelled as Reason R:
Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule.
In the light of the above statements, choose the most appropriate answer from options given below:
Q21.
mcq single
+4 / 1
Vital capacity of lung is ________.
Q22.
mcq single
+4 / 1
In gene gun method used to introduce alien DNA into host cells, microparticles of ________ metal are used.
Q23.
mcq single
+4 / 1
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct
sequence.
A. Insertion of recombinant DNA into the host cell
B. Cutting of DNA at specific location by restriction enzyme
C. Isolation of desired DNA fragment
D. Amplification of gene of interest using PCR
Choose the correct answer from the options given below :
Q24.
mcq single
+4 / 1
During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out
Q25.
mcq single
+4 / 1
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure,
rage, fear etc. are:
Q26.
mcq single
+4 / 1
Match List I with List II with respect to human eye.
List I
List II
(A)
Fovea
(I)
Visible coloured portion of eye that regulates diameter of pupil.
(B)
Iris
(II)
External layer of eye formed of dense connective tissue.
(C)
Blind spot
(III)
Point of greatest visual acuity or resolution.
(D)
Sclera
(IV)
Point where optic nerve leaves the eyeball and photoreceptor cells are absent.
Choose the correct answer from the options given below:
Q27.
mcq single
+4 / 1
Given below are two statements :
Statement I : Endarch and exarch are the terms often used for describing the position of secondary xylem
in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below:
Q28.
mcq single
+4 / 1
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : Late wood has fewer xylary elements with narrow vessels.
Reason R : Cambium is less active in winters.
In the light of the above statements, choose the correct answer from the options given below :
Q29.
mcq single
+4 / 1
How many different proteins does the ribosome consist of?
Q30.
mcq single
+4 / 1
Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:
Q31.
mcq single
+4 / 1
In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This
phenomenon may be called as
Q32.
mcq single
+4 / 1
Which of the following functions is carried out by cytoskeleton in a cell?
Q33.
mcq single
+4 / 1
Upon exposure to UV radiation, DNA stained with ethidium bromide will show
Q34.
mcq single
+4 / 1
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Q35.
mcq single
+4 / 1
Given below are two statements:
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a
region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone
octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
Q36.
mcq single
+4 / 1
Unequivocal proof that DNA is the genetic material was first proposed by
Q37.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Gene 'a'
(I)
$$\beta$$-galactosidase
(B)
Gene 'y'
(II)
Transacetylase
(C)
Gene 'i'
(III)
Permease
(D)
Gene 'z'
(IV)
Repressor protein
Choose the correct answer from the options given below :
Q38.
mcq single
+4 / 1
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA
formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?
Q39.
mcq single
+4 / 1
Expressed Sequence Tags (ESTs) refers to
Q40.
mcq single
+4 / 1
In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
Q41.
mcq single
+4 / 1
Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
Q42.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Ringworm
(I)
Haemophilus influenzae
(B)
Filariasis
(II)
Trichophyton
(C)
Malaria
(III)
Wuchereria bancrofti
(D)
Pneumonia
(IV)
Plasmodium vivax
Choose the correct answer from the options given below:
Q43.
mcq single
+4 / 1
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its
early treatment?
Q44.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Heroin
(I)
Effect on cardiovascular system
(B)
Marijuana
(II)
Slow down body function
(C)
Cocaine
(III)
Painkiller
(D)
Morphine
(IV)
Interfere with transport of dopamine
Choose the correct answer from the options given below:
Q45.
mcq single
+4 / 1
Given below are two statements:
Statement I : Gause’s ‘Competitive Exclusion Principle’ states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II : In general, carnivores are more adversely affected by competition than herbivores.
In the light of the above statements, choose the correct answer from the options given below:
Q46.
mcq single
+4 / 1
Match List I with List II.
List I
(Interacting species)
List II
(Name of interaction)
(A)
A Leopard and a Lion in a forest/grassland
(I)
Competition
(B)
A Cuckoo laying egg in a Crow's nest
(II)
Brood parasitism
(C)
Fungi and root of a higher plant in Mycorrhizae
(III)
Mutualism
(D)
A cattle egret and a Cattle in a field
(IV)
Commensalism
Choose the correct answer from the options given below.
Q47.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Logistic growth
(I)
Unlimited resource availability condition
(B)
Exponential growth
(II)
Limited resource availability condition
(C)
Expanding age pyramid
(III)
The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
(D)
Stable age pyramid
(IV)
The percent individuals of pre-reproductive and reproductive age group are same
Choose the correct answer from the options given below:
Q48.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
P-wave
(I)
Beginning of systole
(B)
Q-wave
(II)
Repolarisation of ventricles
(C)
QRS complex
(III)
Depolarisation of atria
(D)
T-wave
(IV)
Depolarisation of ventricles
Choose the correct answer from the options given below :
Q49.
mcq single
+4 / 1
Which of the following statements are correct?
A. Basophils are most abundant cells of the total WBCs
B. Basophils secrete histamine, serotonin and heparin
C. Basophils are involved in inflammatory response
D. Basophils have kidney shaped nucleus
E. Basophils are agranulocytes
Choose the correct answer from the options given below:
Q50.
mcq single
+4 / 1
Among eukaryotes, replication of DNA takes place in :
Q51.
mcq single
+4 / 1
Select the correct statements.
A. Tetrad formation is seen during Leptotene.
B. During Anaphase, the centromeres split and chromatids separate.
C. Terminalization takes place during Pachytene.
D. Nucleolus, Golgi complex and ER are reformed during Telophase.
E. Crossing over takes place between sister chromatids of homologous chromosome.
Choose the correct answer from the options given below:
Q52.
mcq single
+4 / 1
The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
Q53.
mcq single
+4 / 1
Which of the following stages of meiosis involves division of centromere?
Q54.
mcq single
+4 / 1
Match List I with List II:
List I
List II
(A)
M Phase
(I)
Proteins are synthesized
(B)
G$$_2$$ Phase
(II)
Inactive phase
(C)
Quiescent stage
(III)
Interval between mitosis and initiation of DNA replication
(D)
G$$_1$$ Phase
(IV)
Equational division
Choose the correct answer from the options given below :
Q55.
mcq single
+4 / 1
Given below are two statements:
Statement I : During G~0~ phase of cell cycle, the cell is metabolically inactive.
Statement II : The centrosome undergoes duplication during S phase of interphase.
In the light of the above statements, choose the most appropriate answer from the options given below:
Q56.
mcq single
+4 / 1
Which of the following statements are correct regarding female reproductive cycle?
A. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B. First menstrual cycle begins at puberty and is called menopause.
C. Lack of menstruation may be indicative of pregnancy.
D. Cyclic menstruation extends between menarche and menopause.
Choose the most appropriate answer from the options given below:
Q57.
mcq single
+4 / 1
Given below are two statements:
Statement I: Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory
duct.
Statement Il: The cavity of the cervix is called cervical canal which along with vagina forms birth canal.
In the light of the above statements, choose the correct answer from the options given below:
Q58.
mcq single
+4 / 1
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: Endometrium is necessary for implantation of blastocyst.
Reason R: In the absence of fertilization, the corpus luteum degenerates that causes disintegration of
endometrium.
In the light of the above statements, choose the correct answer from the options given below:
Q59.
mcq single
+4 / 1
Which of the following are NOT under the control of thyroid hormone?
A. Maintenance of water and electrolyte balance
B. Regulation of basal metabolic rate
C. Normal rhythm of sleep-wake cycle
D. Development of immune system
E. Support the process of RBCs formation
Choose the correct answer from the options given below:
Q60.
mcq single
+4 / 1
Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction of species?
Q61.
mcq single
+4 / 1
The historic Convention on Biological Diversity, ‘The Earth Summit’ was held in Rio de Janeiro in the year
Q62.
mcq single
+4 / 1
Which hormone promotes internode/petiole elongation in deep water rice?
Q63.
mcq single
+4 / 1
Spraying of which of the following phytohormone on juvenile conifers helps hastening the maturity period,
that leads early seed production?
Q64.
mcq single
+4 / 1
Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of
Q65.
mcq single
+4 / 1
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : ATP is used at two steps in glycolysis.
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in
conversion of fructose-6-phosphate into fructose-1, 6-diphosphate.
In the light of the above statements, choose the correct answer from the options given below :
Q66.
mcq single
+4 / 1
Match List I with List II:
List I
List II
(A)
Oxidative decarboxylation
(I)
Citrate synthase
(B)
Glycolysis
(II)
Pyruvate dehydrogenase
(C)
Oxidative phosphorylation
(III)
Electron transport system
(D)
Tricarboxylic acid cycle
(IV)
EMP pathway
Choose the correct answer from the options given below :
Q67.
mcq single
+4 / 1
Which of the following combinations is required for chemiosmosis?
Q68.
mcq single
+4 / 1
Which of the following statements are correct regarding skeletal muscle?
A. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:
Q69.
mcq single
+4 / 1
Match List I with List II.
List I
(Type of Joint)
List II
(Found between)
(A)
Cartilaginous Joint
(I)
Between flat skull bones
(B)
Ball and Socket Joint
(II)
Between adjacent vertebrae in vertebral column
(C)
Fibrous Joint
(III)
Between carpal and metacarpal of thumb
(D)
Saddle joint
(IV)
Between Humerus and Pectoral girdle
Choose the correct answer from the options given below:
Q70.
mcq single
+4 / 1
Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
Q71.
mcq single
+4 / 1
Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
Q72.
mcq single
+4 / 1
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A : Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex
and medulla.
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have longer loop
of Henle.
In the light of the above statements, choose the correct answer from the options given below :
Q73.
mcq single
+4 / 1
Which of the following statements are correct?
A. An excessive loss of body fluid from the body switches off osmoreceptors.
B. ADH facilitates water reabsorption to prevent diuresis.
C. ANF causes vasodilation.
D. ADH causes increase in blood pressure.
E. ADH is responsible for decrease in GFR.
Choose the correct answer from the options given below:
Q74.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Taenia
(I)
Nephridia
(B)
Paramoecium
(II)
Contractile vacuole
(C)
Periplaneta
(III)
Flame cells
(D)
Pheretima
(IV)
Urecose gland
Choose the correct answer from the options given below :
Q75.
mcq single
+4 / 1
Match List I with List II.
List I
List II
(A)
Vasectomy
(I)
Oral method
(B)
Coitus interruptus
(II)
Barrier method
(C)
Cervical caps
(III)
Surgical method
(D)
Saheli
(IV)
Natural method
Choose the correct answer from the options given below:
Q76.
mcq single
+4 / 1
Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A : Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health
Care Programme.
Reason R : Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below.
Q77.
mcq single
+4 / 1
Large, colourful, fragrant flowers with nectar are seen in
Q78.
mcq single
+4 / 1
What is the function of tassels in the corn cob?
Q79.
mcq single
+4 / 1
Given below are two statements : One labelled as Assertion A and the other labelled as Reason R :
Assertion A : In gymnosperms the pollen grains are released from the microsporangium and carried by air
currents.
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are
discharged and pollen tube is not formed.
In the light of the above statements, choose the correct answer from the options given below :
Q80.
mcq single
+4 / 1
In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
Q81.
mcq single
+4 / 1
Given below are two statements : One is labelled as Assertion A and the other is labelled as Reason R :
Assertion A : A flower is defined as modified shoot wherein the shoot apical meristem changes to floral
meristem.
Reason R : Internode of the shoot gets condensed to produce different floral appendages laterally at
successive node instead of leaves.
In the light of the above statements, choose the correct answer from the options given below :
Q82.
mcq single
+4 / 1
Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the
characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
Q83.
mcq single
+4 / 1
Given below are two statements :
Statement I : Low temperature preserves the enzyme in a temporarily inactive state whereas high
temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II : When the inhibitor closely resembles the substrate in its molecular structure and inhibits the
activity of the enzyme, it is known as competitive inhibitor.
In the light of the above statements, choose the correct answer from the options given below:
Q84.
mcq single
+4 / 1
Cellulose does not form blue colour with Iodine because
Q85.
mcq single
+4 / 1
Given below are two statements:
Statement I: A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and
the right end represented by last amino acid (N-terminal).
Statement II: Adult human haemoglobin, consists of 4 subunits (two subunits of $$\alpha$$ type and two subunits of $$\beta$$ type.)
In the light of the above statements, choose the correct answer from the options given below:
Q86.
mcq single
+4 / 1
Which of the following is not a cloning vector?